kaanan8459 kaanan8459

22-05-2023
Biology

contestada

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3'

Respuesta :

Otras preguntas

PLEASE HELP ASAP Thank you!!! <3

Which reason shows best why the US would keep the Philippines as a territory causing the Philippine-American War? The Philippines were under joint control wit

who built the first cities in north carolina?

help asap When the U.S. discovered that Soviets were placing nuclear missiles in Cuba, Americans worried because a. any missile launched from Cuba could hit th

What the reasons people choose to settle in the west in the late 1800s?

When entrepreneurs bring a new product to market or use a new production method, they are?

which value for y completes the proportion? 18/27 = 2/y what would the answer be? A. 1 B. 2 C. 3 D.9?

How do i put the square root of 32 into simplest radical form?

How to draw an ionic bond between sodium and fluorine

Which stylized phrase in paragraphs 3-4 most effectively captures hurston’s feelings about her interactions with the tourists who passed through her childhood t