helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

What are the factors of 49x^6?

Using the above set-up what is the phenotypic ratio of the offspring of this cross? a.1:1:1:1 b.3:1 c.1:2:1 d.4:0

The area of a triangle is ½ (b) (h), where the base and height are always two sides of the triangle. a. True b. False

Which of the following should be filed immediately after bogart

When you connect to your isp's pop, the isp and the equipment at the pop go through a process called _________, establishing the speed of the internet connectio

Find the measures of the interior angles of a triangle whose two exterior angles equal to 120° and 150°

The Inca were conquered by Cortes. true or false

You come to work one morning to discover the electricity has gone off in the refrigerator in the laboratory. This refrigerator houses the reagents needed to per

Which of the following is a subatomic particle located inside the nucleus of an atom

How to solve if sin x=0.76 what is cos x=