jensoriacalzadi4493 jensoriacalzadi4493
  • 25-05-2020
  • Mathematics
contestada

p and q are complex numbers such that |p|=3/4x+2, |q|=2x+1, and |p+q|=2/3x-2. On what interval must x fall on?


Answer choices:

a.(-infinity, -13/5]

b.[3, infinity)

c.[-8/3,-13/5]

d.[-8/3, -1/2]

Respuesta :

temdan2001
temdan2001 temdan2001
  • 27-05-2020

Answer: B

( - 3 , infinity )

Step-by-step explanation:

Given that

|p| = 3/4x+2

|q| = 2x+1

|p+q| = 2/3x-2

|p| + |q| = |p+q|

That is

3/4x+2 + 2x+1 = 2/3x-2

(3x + 8)/4 + 2x + 1 = (2x - 6)/3

(3x + 8 + 8x + 4)/4 = (2x - 6)/3

Cross multiply

9x + 24 + 24x + 12 = 8x - 24

Collect the like terms

33x + 36 = 8x - 24

33x - 8x = - 24 - 36

25x = - 60

X = -60/25

X = - 2.4

X should fall on the interval of

( -3, infinity)

Answer Link

Otras preguntas

Bob and Pete's Consulting Company charges a $50 base fee for consultations, plus $20/hour. Write an equation to represent this situation
To bring 1.0kg of water from 25Cto 99C takes how much heat input?
Which one of the following scenarios accurately describes a condition in which resonance can occur? A. A vibrating tuning fork is struck and begins to v
x= a) 39 b) 40 c) 41
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
a square pyramid has a height of 7 feet the perimeter of the base is 42 feet. Find the surface area of the pyramid.
Malaysia and Indonesia are two separate island True or false
Which of the following is a bill that would most likely start in the house? HR9528 9528BHR 39528 9528SHR
749.3 times .037 show work pls
This mountain buried the city of Pompeii in 79 A.D.