ochoaloca7 ochoaloca7
  • 24-01-2018
  • Health
contestada

What ar five stages of physical activity behavior

Respuesta :

catwhite535
catwhite535 catwhite535
  • 24-01-2018
the five stages are 
can be distinguished as:
pre contemplation, contemplation, preparation, action and maintenance.
Answer Link

Otras preguntas

A combination lock has 40 numbers on it. How many different 3-digit lock combinations are possible if no digit can be repeated?
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
S toddlers (ages 1–3 years) begin to explore their world, they learn that they can control their actions and act on the environment to get results. what is the
Convection in the upper mantlemagma injection at the spreading boundariesgravity pulling the plates downward at subduction zonesThese are three theorized causes
The Quick Styles gallery can be opened by following these steps:
Germany wanted to build up her empire this is known as
In a random sample of 160 high school students, 64% of the students participated in summer camp activities. The estimate had a margin of error of 2.5% at a 95%
There are 1200 students at Sophie’s school. One student’s name will be drawn at random to win a new bike. What is the probability that Sophie will win the bike?
Each army was led by a different _______
Why are parentheses used in this sentence?