Seudónimo Seudónimo

25-05-2018
Mathematics

contestada

What is 1 4/5 + 1 1/5??

Respuesta :

25-05-2018

[tex]1\dfrac{4}{5}+1\dfrac{1}{5}=(1+1)+\left(\dfrac{4}{5}+\dfrac{1}{5}\right)=2+\dfrac{1+4}{5}=2+\dfrac{5}{5}=2+1=3[/tex]

Answer Link

Otras preguntas

What is an example of bias by ommision

Sadler Corporation purchased equipment to be used in manufacturing. The purchase was made at the beginning of 2015 by paying cash of $150,000. The equipment has

Which equation represents a line that has a slope of One-third and passes through point (–2, 1)? y = one-third x minus 1 y = one-third x + five-thirds y = one-t

The area of a rectangular desk is given by the trinomial x squared (idk how to type that lol) -7x -18. What are the possible dimensions of the desk? Use factori

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please

Benjamin invest 400 in savings account that earns 5% each year

Where did the Emancipation Proclamation free slaves? Where didn't the Emancipation Proclamation free slaves?

If a triangle has side lengths of 7 cm, 10 cm, and 12 cm, is it a right triangle ?

Who was Robert Ellicot? (reconstruction period)

Can someone give me a really specific explanation on how to do this, so I can try to do it myself please? Solve for x.