19gaffinwhi
19gaffinwhi 19gaffinwhi
  • 22-08-2018
  • History
contestada

Which economic mechanism does a barter system operate without? A. opportunity costs B. money C. supply and demand D. goods and services

Respuesta :

jazzdalski
jazzdalski jazzdalski
  • 22-08-2018

Hi!

The answer is B. Money. Hope this helps! :)

Answer Link
alexiamariewigg alexiamariewigg
  • 04-10-2018

The Answer Is B Money

Answer Link

Otras preguntas

Which point is located at (6,3)?es 0)A)AB)BC)CD)E​
The Black Panther Party believed that A. African Americans should not organize to fight against oppression. B. the African American community was responsible fo
La mamá levanta al niño con los
PLEASE HELP ASAP!!!!
Will someone help me with this one please?
Choose the correct placement for the commas in this sentence. Angel's first cat Alistair acts like he's better than the other two. Choose 1 answer: A Angel's fi
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
What was the Middle Passage? Explain two factors that made it a terrible experience.
Ab-cd= A=5 b=3 c=4 d=2
What type of light do most objects produce?